The reporter dye information for TaqMan Drug Metabolism and SNP Genotyping Assays can be found in the context sequence, which is posted on the Thermo Fisher Scientific website and in the Assay Information File (AIF) that is on your assay order CD. The context sequence is the nucleotide sequence surrounding the SNP site. It is provided in the genome strand orientation relative to the NCBI reference genome. The SNP alleles are included in brackets, where the order of the alleles corresponds to the association with probe reporter dyes, where [Allele 1 = VIC dye / Allele 2 = FAM dye].

For example, the C__27102431_D0 assay, which targets the CYP2D6*4 g.1846G A SNP, rs3892097, has the following context sequence:

AGACCGTTGGGGCGAAAGGGGCGTC[C/T]TGGGGGTGGGAGATGCGGGTAAGGG

The VIC dye probe is associated with the C allele and the FAM dye probe is associated with the T allele.

Note that occasionally the SNP alleles we provide in the context sequence are the complement of those listed on the NCBI website, or of those given in the star allele nomenclature. This is because we provide the context sequence alleles in the reference genome strand orientation, but in this example, RefSNP alleles in dbSNP (NCBI) and the star allele nucleotide changes are provided with respect to the CYP2D6 gene reference sequence that maps to the genome strand: CYP2D6*4 g.1846G A. In the case of A/T, T/A, C/G, or G/C polymorphisms, it is important to note the context sequence to make sure that you have identified the alleles correctly.

For custom assays, only probe sequences are provided for designs created by the Custom Assay Design Tool (CADT). The alleles corresponding to VIC dye and FAM dye are determined by the order of the SNP alleles included in brackets of the sequence you submitted for assay design, where the order of the alleles corresponds to the association with probe reporter dyes, where [Allele 1 = VIC dye / Allele 2 = FAM dye]. If you no longer have the submitted sequences and have trouble determining which allele is detected by each dye based on the probe sequences in the AIF on the CD you can contact tech support for help.

If a custom assay is designed based on the reverse strand sequence, the alleles detected by each dye are the same as they would be for an assay based on the forward strand sequence. For example, if a submitted SNP sequence is GTC[C/T]TGG the VIC probe sequence in the AIF file may contain GTCCTGG or the reverse complement CCAGGAC and the FAM probe sequence may contain GTCTTGG or the reverse complement CCAAGAC of the context sequence. Both the forward and reverse strand VIC probes target the C allele and both FAM probes target the T allele of the SNP.

这个回答对您是否有帮助？